| Primary Identifier | MGI:6342500 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Aftph |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAAAACAGATACTATCCA and GGTTTTTGAGACTAATGCCC, which resulted in a 2354 bp deletion beginning at Chromosome 11 position 20,725,445 bp and ending after 20,727,798 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000494059 (exon 2) and 399 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to generate a null allele. |