| Primary Identifier | MGI:6317336 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rcor3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGATGGAACCAGGCCTCACG and TTAGTAAAGGTACCACGACA, which resulted in a 474 bp deletion beginning at Chromosome 1 position 192,124,003 bp and ending after 192,124,476 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000504238 (exon 6) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 170. There is a 1 bp insertion C at the deletion site. |
