|  Help  |  About  |  Contact Us

Allele : Smim20<em1(IMPC)J> small integral membrane protein 20; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6317363 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Smim20
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTGGGTGTGACATTACAAG and TACAAATAGCTATTACTACA, which resulted in a 1929 bp deletion beginning at Chromosome 5 position 53,276,856 bp and ending after 53,278,784 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254968 and ENSMUSE00000766691 (exons 2 and 3) and 1228 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 38 and early truncation 2 amino acids later. There is a 2 bp TG insertion at the deletion site. RT-qPCR analysis demonstrated the absence of Smim20 mRNA expression in the hypothalamus of homozygous mutant females.
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • Smim20 KO,
  • Smim20 KO
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

6 Publication categories

Trail: Allele