| Primary Identifier | MGI:6342782 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Szrd1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTACGATCACTTAACCTGA and TGGACCCCATCATTAGGTGG, which resulted in a 2291 bp deletion beginning at Chromosome 4 position 141,118,303 bp and ending after 141,120,593 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001245055, ENSMUSE00001251800 (exons 2,3) and 1986 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 17 and early truncation 23 amino acids later. |
