| Primary Identifier | MGI:6342819 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Eepd1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACAGGTCCGAGGGATCTCT and GGTGGTGTGCATGACGCTTC, which resulted in a 661 bp deletion beginning at Chromosome 9 position 25,482,477 bp and ending after 25,483,137 bp (GRCm38/mm10). This mutation deletes 661 bp of ENSMUSE00000410963 (exon 2) and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 11 amino acids later. There is a 4 bp deletion (GCTT) 166 bp downstream of the 661 bp deletion. |
