| Primary Identifier | MGI:6342905 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rcc1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1319 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes single guide RNAs having spacer sequences of AGCCAGTAAATAATCTCGAA and AGTCTGCGAACTGTGTTGGG and 2 single-strand oligonucleotides to introduce loxP sites. The loxP sites were not incorporated into this allele instead a 815-bp Chr4: 132335167 to 132335981_insGACTCCTG. |
