| Primary Identifier | MGI:6342821 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tubal3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCCACTGCATTGTTCTGCC and CTGCACTGGTACATCACAGA, which resulted in a 859 bp deletion beginning at Chromosome 13 position 3,932,618 bp and ending after 3,933,476 bp (GRCm38/mm10). This mutation deletes 859 bp of ENSMUSE00000644094 (exon 4) and is predicted to cause a change of amino acid sequence after residue 133 and early truncation 6 amino acids later. |
