| Primary Identifier | MGI:6381400 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fhod1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGCAGAGAACAATGCCGG and CATCAAGCTACAGCCCTGGA, which resulted in a 404 bp deletion beginning at Chromosome 8 position 105,338,685 bp and ending after 105,339,088 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001204882 (exon 2) and 297 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 109 amino acids later. |