|  Help  |  About  |  Contact Us

Allele : Ano6<em1Tcp> anoctamin 6; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6323003 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ano6
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false
molecularNote  This allele from project TCPR0240 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and a single guide RNA with spacer sequence GGATCGGGTCTGTCCCGTTG along with a single-strand oligonucleotide repair template. Homology-directed repair resulted in c.1483G>C that is predicted to cause p.G495R at Chromosome 15 95948365 bp (GRCm38).
  • mutations:
  • Single point mutation
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele