| Primary Identifier | MGI:6323003 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ano6 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele from project TCPR0240 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and a single guide RNA with spacer sequence GGATCGGGTCTGTCCCGTTG along with a single-strand oligonucleotide repair template. Homology-directed repair resulted in c.1483G>C that is predicted to cause p.G495R at Chromosome 15 95948365 bp (GRCm38). |
