| Primary Identifier | MGI:6324365 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zmym2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAACCACAGATTAGATCA and CATGCATCAATATAGAGTAC, which resulted in a 321 bp deletion beginning at Chromosome 14 position 56,912,866 bp and ending after 56,913,186 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000309143 (exon 4) and 155 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 377 and early truncation 9 amino acids later. There is an 8 bp insertion (GCATGATT) at the deletion site. |
