|  Help  |  About  |  Contact Us

Allele : Zmym2<em1(IMPC)J> zinc finger, MYM-type 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6324365 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zmym2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAACCACAGATTAGATCA and CATGCATCAATATAGAGTAC, which resulted in a 321 bp deletion beginning at Chromosome 14 position 56,912,866 bp and ending after 56,913,186 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000309143 (exon 4) and 155 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 377 and early truncation 9 amino acids later. There is an 8 bp insertion (GCATGATT) at the deletion site.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele