| Primary Identifier | MGI:6324240 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zbtb37 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTAGGATCAGTAATTGCCA and AGTTCAAACATCCCTACAAA, which resulted in a 1328 bp deletion beginning at Chromosome 1 position 161,031,517 bp and ending after 161,032,844 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000947438 (exon 3) and 368 bp of flanking intronic sequence including the splice acceptor and donor and start site and is predicted to generate a null allele. |
