|  Help  |  About  |  Contact Us

Allele : Nanos2<em1(IMPC)Bay> nanos C2HC-type zinc finger 2; endonuclease-mediated mutation 1, Baylor College of Medicine

Primary Identifier  MGI:6330714 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nanos2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6N
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 RNA and 2 guide sequences ACCTACCGCCCTTTGACATGTGG, CCGACGCAGTGGGCGAAACTCAG, which resulted in a Exon Deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele