| Primary Identifier | MGI:6381997 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Klhl9 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGATCTGAAGGTGCTGAAAG and GTCTCTGGGTAACGGCGACA, which resulted in a 1826 bp deletion beginning at Chromosome 4 position 88,720,160 bp and ending after 88,721,985 bp (GRCm38/mm10). This mutation deletes 1826 bp of ENSMUSE00000603001 (exon 1) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 30 amino acids later. |
