|  Help  |  About  |  Contact Us

Allele : Gje1<em3(IMPC)H> gap junction protein, epsilon 1; endonuclease-mediated mutation 3, Harwell

Primary Identifier  MGI:6355935 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gje1
Strain of Origin  C57BL/6NTac Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 4 guide sequences GCCAGAATGCGAACACCTCCAGG, CCAGAATGCGAACACCTCCAGGC, GGTTTATCTCTCGCTTGTCTGGG, AGGTTTATCTCTCGCTTGTCTGG, which resulted in an intragenic deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele