|  Help  |  About  |  Contact Us

Allele : Irgc<em1(IMPC)Tcp> immunity related GTPase cinema; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6355937 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Irgc
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at The Centre for Phenogenomics by injecting CAS9 Protein and 3 guide sequences CCGTGCCGAAGCTGATACCCCCG, CCCGAAGGCGAGAGGCGGCTTGA, CCCCAGGCCGCGTAGGGCATTGA, which resulted in an intragenic deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele