| Primary Identifier | MGI:6357940 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cldn23 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCTACAGGTCGGAGTCACA and GACGCCGGTGGTGATGACGC, which resulted in a 860 bp deletion beginning at Chromosome 8 position 35,825,454 bp and ending after 35,826,313 bp (GRCm38/mm10). This mutation deletes 860 bp of ENSMUSE00000448200 (exon 1) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 18 amino acids later. |
