| Primary Identifier | MGI:6357983 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Foxb2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGGTGTTGGTGCATTCTTAG and TAGGAACTCTTCCCTGGCCG, which resulted in a 1274 bp deletion beginning at Chromosome 19 position 16,872,358 bp and ending after 16,873,631 bp (GRCm38/mm10). This mutation deletes 1274 bp of ENSMUSE00000462680 (exon 1) and is predicted to cause a change of amino acid sequence after residue 3 and truncation 33 amino acids later. |
