| Primary Identifier | MGI:6357997 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tktl2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGCGCAGACTTTCCTCAA and TGATTGCAAAGTTTTATGAT, which resulted in a 2265 bp deletion beginning at Chromosome 8 position 66,511,711 bp and ending after 66,513,975 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000151364 (exon 1) and 244 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele. |