| Primary Identifier | MGI:6363565 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pygm |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGCTAGTAAGCCTCACAGG and CAGCCCCCAGAAGATGCCAC, which resulted in a 3639 bp deletion beginning at Chromosome 19 position 6,387,911 bp and ending after 6,391,549 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000551301 through ENSMUSE00000235180 (exons 6-14) and 2531 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 220 and early truncation 15 amino acids later. |