|  Help  |  About  |  Contact Us

Allele : Gk2<em2Juhu> glycerol kinase 2; endonuclease-mediated mutation 2, Junjiu Huang

Primary Identifier  MGI:6359764 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gk2
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  A 14-base deletion of CCAATATCTGGATG (reverse strand) was created using an sgRNA (TTGGAAGGCGTGCCAATATC) and CRISPR/Cas9 technology, creating a null allele.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Gk2<->,
  • Gk2 KO,
  • Gk2 KO,
  • Gk2<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele