| Primary Identifier | MGI:6390575 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fam81b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGGGGAAATAATACAACT and TAGCCCACCACAGCATCACA, which resulted in a 316 bp deletion beginning at Chromosome 13 position 76,268,444 bp and ending after 76,268,759 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001378293 (exon 4) and 241 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 56 and early truncation 31 amino acids later. |
