| Primary Identifier | MGI:6360914 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sec31b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTCCAGCTTTACCACTGGA and AAGAATCAGTCTCAGCACCG, which resulted in a 697 bp deletion beginning at Chromosome 19 position 44,535,584 bp and ending after 44,536,280 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001259906 and ENSMUSE00001257432 (exons 4 and 5) and 405 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 48 amino acids later. |