| Primary Identifier | MGI:6391231 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccdc166 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAAGGAGTGCTCTAACGAC and CCATTCTGTTGCTCTGGCAA, which resulted in a 2917 bp deletion beginning at Chromosome 15 position 75,979,638 bp and ending after 75,982,554 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001276403 and ENSMUSE00001220008 (exons 1 and 2) and 459 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. |
