| Primary Identifier | MGI:6360699 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zbtb12 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGTTTCCCCAATTCCAAGG and TGCCAGGTAAGAGAACACGG, which resulted in a 2053 bp deletion beginning at Chromosome 17 position 34,895,103 bp and ending after 34,897,155 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000341344 (exon 2) and 406 bp of flanking intronic sequence including the start site and splice and is predicted to generate a null allele. |
