Primary Identifier | MGI:6361178 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Cttnbp2nl |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCTTGTTTTATTAGAAAG and TCTCTAATCAAGAGGTGTGG, which resulted in a 4285 bp deletion beginning at Chromosome 3 position 105,001,869 bp and ending after 105,006,153 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001357415 (exon 6) and 73 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 146 and early truncation 8 amino acids later. |