|  Help  |  About  |  Contact Us

Allele : H2-Eb2<b-em1(IMPC)J> histocompatibility 2, class II antigen E beta2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6361196 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  H2-Eb2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTTTTCTGGAGCAGTTGA and CAGAAATAACTATGACCTTG, which resulted in a 218 bp deletion beginning at Chromosome 17 position 34,333,301 bp and ending after 34,333,518 bp (GRCm38/mm10). This mutation deletes 218 bp of ENSMUSE00000411205 (exon 2) and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 11 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • H2-Eb2<em1(IMPC)J>,
  • H2-Eb2<em1(IMPC)J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele