| Primary Identifier | MGI:6376201 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Snx12 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AACCAAGTATGGAATGAAGG and CTTGGGATCTATAATGCCCC, which resulted in a 469 bp deletion beginning at Chromosome X position 101,214,299 bp and ending after 101,214,767 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000407573 (exon 3) and 344 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 9 amino acids later. |