| Primary Identifier | MGI:6376211 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Scoc |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGCCTGGGAACAAGTGAG and ACTCTCCATGCTTTACTGCT, which resulted in a 3865 bp deletion beginning at Chromosome 8 position 83,434,286 bp and ending after 83,438,150 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001247660 through ENSMUSE00001393187 (exons 2-4) and 2163 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 16 amino acids later. |
