|  Help  |  About  |  Contact Us

Allele : Tpx2<em1(IMPC)J> TPX2, microtubule-associated; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6367835 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tpx2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTTCTGCAGTAGTCTGACT and GTTTATGGATTGTAGCTTGC, which resulted in a 253 bp deletion beginning at Chromosome 2 position 152,873,064 bp and ending after 152,873,316 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001204719 (exon 5) and 126 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 76 and early truncation 24 amino acids later. There is a 3 bp insertion (AGA) at the deletion site.
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele