| Primary Identifier | MGI:6379285 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Morn5 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAGCGATGCATCTGAGGA and GATTGGGCAGAATGAAACAT, which resulted in a 327 bp deletion beginning at Chromosome 2 position 36,052,858 bp and ending after 36,053,184 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000257467 (exon 2) and 179 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 16 and early truncation 33 amino acids later. |
