| Primary Identifier | MGI:6379294 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Yif1a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCAGTCGAGAGGCGCACCG and TTAAAGTCACTGGCTCCAAG, which resulted in a 646 bp deletion beginning at Chromosome 19 position 5,091,215 bp and ending after 5,091,860 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000145739 and ENSMUSE00000145750 (exons 5 and 6) and 432 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 142 and early truncation 1 amino acids later. |
