| Primary Identifier | MGI:6385163 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tmem179 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATACGGTGGGGCCATGCCG and TCAACATCGGAACATTTGCA, which resulted in a 1752 bp deletion beginning at Chromosome 12 position 112,503,097 bp and ending after 112,504,848 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000435049 and ENSMUSE00000435046 (exons 2 and 3) and 1535 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 102 and early truncation 18 amino acids later. There is a 3 bp insertion (CTA) at the deletion site. |
