|  Help  |  About  |  Contact Us

Allele : Sap30<em1(IMPC)J> sin3 associated polypeptide; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6388615 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Sap30
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATCCACCTAGGGAAGGTGA and ACCATTCCCGTGGGGCCGCG, which resulted in a 5368 bp deletion beginning at Chromosome 8 position 57,482,549 bp and ending after 57,487,916 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000211137, ENSMUSE00000211139, ENSMUSE00000211140, ENSMUSE00000211138 (exons 1-4) and 4190 bp of flanking intronic sequence including the transcription start site and is predicted to generate a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele