| Primary Identifier | MGI:6388622 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dbpht2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGTCCTTAACCATGAGTGG and ATAGATATCAGCATCTAGGA, which resulted in a 5723 bp deletion beginning at Chromosome 12 position 74,296,535 bp and ending after 74,302,257 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001420864 (exon 1) and 382 bp of flanking intronic sequence including the splice acceptor and start site and is predicted to generate a null allele. |
