| Primary Identifier | MGI:6385279 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pcdhb10 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1495 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGGCTATTTGGTGGCTAATT and GTATGAGGTGTGTTTATCGG targeting a critical region. This resulted in a 2130-bp del Chr18: 37412012-37414141 (p.N47_S757del_insT) (GRCm38). |