|  Help  |  About  |  Contact Us

Allele : Atp5pf<em1(IMPC)Ics> ATP synthase peripheral stalk subunit F6; endonuclease-mediated mutation 1, Mouse Clinical Institute

Primary Identifier  MGI:6367966 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Atp5pf
Inheritance Mode  Not Specified Strain of Origin  C57BL/6N
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Institut Clinique de la Souris by injecting CAS9 RNA and 4 guide sequences CCTCTACTTTAATGACAACAGAC, ATCGGAACGCAAGCTATGTCTGG, CATGTTACCCTTGCACAATAAGG, GACTTACTGGAATTGACTCCTGG, which resulted in a Exon Deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories