|  Help  |  About  |  Contact Us

Allele : Ly6d<em1(IMPC)J> lymphocyte antigen 6 family member D; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6361282 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ly6d
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGAGCCATAACAGTGAGC and CTCACCAGGTTCCCATTCAG, which resulted in a 202 bp deletion beginning at Chromosome 15 position 74,762,378 bp and ending after 74,762,579 bp (GRCm38/mm10). This mutation deletes 202 bp from ENSMUSE00000394284 (exon 3) and is predicted to cause a change of amino acid sequence after residue 54 and termination 87 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele