| Primary Identifier | MGI:6361439 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Smarca2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGGAAGAAATCATAATGC and ATTGATTTCCTACATCACGG, which resulted in a 267 bp deletion beginning at Chromosome 19 position 26,646,911 bp and ending after 26,647,177 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000146234 (exon 6) and 140 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 359 and early truncation 1 amino acids later. |
