|  Help  |  About  |  Contact Us

Allele : Zfyve26<em2(IMPC)J> zinc finger, FYVE domain containing 26; endonuclease-mediated mutation 2, Jackson

Primary Identifier  MGI:6389075 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfyve26
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from IMPC was generated at The Jackson Laboratory by injecting D10A RNA and 2 guide sequences CCTTGTCCCCGGTGTAGTTGAGG, CCAGCGCCTGTAGTATGTCCTCC, which resulted in a Indel.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele