| Primary Identifier | MGI:6361975 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Actl6b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATACTAACTGACATGTGGGC and ACTAGTGCAGAAGGCCCCAT, which resulted in a 293 bp deletion beginning at Chromosome 5 position 137,563,060 bp and ending after 137,563,352 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001374145 (exon 5) and 195 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 123 and early truncation 24 amino acids later. |
