| Primary Identifier | MGI:6385644 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gtsf1l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTTAGTTAGGCCTTCCCTA and AACCCCTTATTCATCAGCGT, which resulted in a 1255 bp deletion beginning at Chromosome 2 position 163,086,776 bp and ending after 163,088,030 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000597815 (exon 1) and 433 bp of flanking intronic sequence including the splice acceptor, start site and donor and is predicted to generate a null allele. There is a 3 bp insertion (TTA) 5 bp after the deletion site. |
