| Primary Identifier | MGI:6385688 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Insyn2b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCCAGCAAAGTATGAAAGTG and AAGCTCACGCTCTCACTGAA, which resulted in a 1327 bp deletion beginning at Chromosome 11 position 34,401,977 bp and ending after 34,403,303 bp (GRCm38/mm10). This mutation deletes 1327 bp of ENSMUSE00000881654 (exon 2) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 26 amino acids later. |