| Primary Identifier | MGI:6385694 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cox7a2l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTTTCAAACTAATCATAG and CGTCCTGTGGACAAAGAGGG, which resulted in a 12,878 bp deletion beginning at Chromosome 17 position 83,501,735 bp and ending after 83,514,612 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000341244, ENSMUSE00000140226, ENSMUSE00001454054 (exons 1,2,3) and 465 bp of flanking intronic sequence including the splice acceptor start site and donor and is predicted to generate a null allele. |
