|  Help  |  About  |  Contact Us

Allele : Cox7a2l<em1(IMPC)J> cytochrome c oxidase subunit 7A2 like; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6385694 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cox7a2l
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTTTCAAACTAATCATAG and CGTCCTGTGGACAAAGAGGG, which resulted in a 12,878 bp deletion beginning at Chromosome 17 position 83,501,735 bp and ending after 83,514,612 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000341244, ENSMUSE00000140226, ENSMUSE00001454054 (exons 1,2,3) and 465 bp of flanking intronic sequence including the splice acceptor start site and donor and is predicted to generate a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele