| Primary Identifier | MGI:6380682 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Lysmd4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATTCTGTGTCAGTATCAGG and ACAGCATTAGAGTAGCTGAC, which resulted in a 5123 bp deletion beginning at Chromosome 7 position 67,223,456 bp and ending after 67,228,578 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000466123 and ENSMUSE00001380362 (exons 2 and 3) and 2247 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted generate a null allele. |
