|  Help  |  About  |  Contact Us

Allele : Zfp518b<em1(IMPC)J> zinc finger protein 518B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6362954 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp518b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTTCGGACATTAAATGGGG and CATGAACTTGAGCTACCTGG, which resulted in a 6658 bp deletion beginning at Chromosome 5 position 38,668,433 bp and ending after 38,675,090 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001363757 (exon 4) and 290 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to generate a null allele. There is a 6 bp insertion at the deletion site (CATGTG).
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele