|  Help  |  About  |  Contact Us

Allele : Zbtb34<em1(IMPC)J> zinc finger and BTB domain containing 34; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6382793 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zbtb34
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGGCACTAGATTCCCGCC and ACGTTTCGTGTCGGGAGAAA, which resulted in a 1469 bp deletion beginning at Chromosome 2 position 33,411,009 bp and ending after 33,412,477 bp (GRCm38/mm10) plus the insertion at the deletion site of a 61 bp sequence from ENSMUSE00000694537 (exon 3) in inverse orientation (GGGAATCTAGTGCCATCTCTGAGGCTGATGCATCACTTTCGAGTTTCTGTTCCACATACAT). This is predicted to cause a change of amino acid sequence after residue 17 and early truncation 2 amino acids later.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele