| Primary Identifier | MGI:6385911 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pcdha9 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATAGTTCGCTGTTTCTCAG and TTAAAAATACTTGTGCATAG, which resulted in a 2665 bp deletion beginning at Chromosome 18 position 36,997,816 bp and ending after 37,000,480 bp (GRCm38/mm10). This mutation deletes 2665 bp from ENSMUSE00000703749 (exon 1) including the splice acceptor, start site and donor and is predicted to a null allele. |
