|  Help  |  About  |  Contact Us

Allele : Cstad<em1(IMPC)J> CSA-conditional, T cell activation-dependent protein; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6383182 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cstad
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCAGCTGAGCCATAACGG and TCATGAGTTGGTACAGCCAG, which resulted in a 228 bp deletion beginning at Chromosome 2 position 30,608,209 bp and ending after 30,608,436 bp (GRCm38/mm10). This mutation deletes 228 bp from ENSMUSE00000662814 (exon 2) and is predicted to cause a change of amino acid sequence after residue 17 deletes 76 amino acids and remains in frame for the last 11 amino acids before the stop colon.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele