| Primary Identifier | MGI:6392173 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Setbp1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Guide RNAs [TCCCGATGCCACTGTCGCTC and GAGACTATCCCGAGCGACAG] were originally designed to introduce a point mutation in exon 4. DNA sequencing of the targeted region identified genome edited pups harboring a Setbp1 98-nt frameshift deletion (indel mutation) that starts at Pro-857 and introduces a TGA stop codon immediately afterwards [GCGAGGAGACTATCCC//del98//TTGACAACCCAGAGGCC]. |
