| Primary Identifier | MGI:6401351 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tex21 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAAGGAGAGAGTTCGGCGT and TTTGAATGAGAGAAATTCAC, which resulted in a 6247 bp deletion beginning at Chromosome 12 position 76,239,314 bp and ending after 76,245,560 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000369176 and ENSMUSE00000284491 (exons 2 and 3) and 5767 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. |
